-
D Schmidt, MD Wilson, B Ballester, PC Schwalie, GD Brown, A Marshall, C Kutter, S Watt, CP Martinez-Jimenez, S Mackay, I Talianidis, P Flicek, DT Odom. Five-Vertebrate ChIP-seq Reveals the Evolutionary Dynamics of Transcription Factor Binding. Science 2010;328(5981):1036–1040.
[Bibtex]@Article{20378774, author = {Schmidt D and Wilson MD and Ballester B and Schwalie PC and Brown GD and Marshall A and Kutter C and Watt S and Martinez-Jimenez CP and Mackay S and Talianidis I and Flicek P and Odom DT}, title = {Five-Vertebrate ChIP-seq Reveals the Evolutionary Dynamics of Transcription Factor Binding}, journal = {Science}, volume = {328}, number = {5981}, pages = {1036--1040}, year = {2010}, doi = {10.1126/science.1186176}, abstract = {Transcription factors (TFs) direct gene expression by binding to DNA regulatory regions. To explore the evolution of gene regulation, we experimentally determined the genome-wide occupancy of two TFs, CEBPA and HNF4A, in livers of five vertebrates. Although each TF displays highly conserved DNA binding preferences, most binding is species-specific, and aligned binding events present in all five species are rare. Regions near genes with expression levels dependent on a TF are often bound by the TF in multiple species, yet show no enhanced DNA sequence constraint. Binding divergence between species can be largely explained by sequence changes to the bound motifs. Among the binding events lost in one lineage, only half are recovered by another binding event within 10 kilobases. Our results reveal large interspecies differences in transcriptional regulation and provide insight into their evolution.},}
Description
As published in Science, researchers from Cambridge, Glasgow and Greece have discovered a remarkable amount of plasticity in how transcription factors maintain their function over large evolutionary distances… more.Raw Data
The mutli-species CEBPA and HNF4A reads can be found at ArrayExpress with the accesion number E-TABM-722. Chromatin immunoprecipitation sequencing: E-TABM-722The TC1 expression data can be found at ArrayExpress with the accesion number E-MTAB-178. Gene expression experiments: E-MTAB-178.
Peak calls
Peaks calls made using SWEMBL are provided as bed files (chro, start, end).Peaks calls for 5 species – lenient cutoff (*.tar.gz)
Peaks calls for 3 species – lenient cutoff (*.tar.gz)
HNF4A peak calls with nreads – stringent cutoff (*.gz)
Fasta files used for motifs discovery
Fasta files here. Those files contains the seqeunces +/-12bp around the summit of the top 500 peaks.The format is as below:
>16007:20:47738098:47738521:hsap GATTAAAGTTCAGGACACACCATGG Where the header means: >internal_id:chro:start:end:speciesStart and End are the actual peaks coordinates, so you can extract the entire sequence of those peaks.
Antibody catalog numbers
Correction: HNF4A antibody – N-terminal region (ARP31946) and Sc-8987.Motifs matrices
Below is the list of position frequency matrices (PFM) for CEBPA and HNF4A.CEBPA Hsap +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 142 | 48 | 109 | 18 | | 2 | 6 | 0 | 0 | 311 | | 3 | 0 | 0 | 87 | 230 | | 4 | 82 | 4 | 169 | 62 | | 5 | 58 | 44 | 31 | 184 | | 6 | 0 | 1 | 316 | 0 | | 7 | 39 | 256 | 0 | 22 | | 8 | 312 | 5 | 0 | 0 | | 9 | 317 | 0 | 0 | 0 | | 10 | 10 | 100 | 29 | 178 | +------+------+------+------+------+ CEBPA Mmus +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 142 | 48 | 109 | 18 | | 2 | 6 | 0 | 0 | 311 | | 3 | 0 | 0 | 87 | 230 | | 4 | 82 | 4 | 169 | 62 | | 5 | 58 | 44 | 31 | 184 | | 6 | 0 | 1 | 316 | 0 | | 7 | 39 | 256 | 0 | 22 | | 8 | 312 | 5 | 0 | 0 | | 9 | 317 | 0 | 0 | 0 | | 10 | 10 | 100 | 29 | 178 | +------+------+------+------+------+ CEBPA Cfam +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 216 | 46 | 145 | 6 | | 2 | 0 | 1 | 0 | 412 | | 3 | 0 | 0 | 79 | 334 | | 4 | 90 | 2 | 254 | 67 | | 5 | 62 | 48 | 46 | 257 | | 6 | 0 | 0 | 413 | 0 | | 7 | 56 | 323 | 0 | 34 | | 8 | 401 | 11 | 1 | 0 | | 9 | 412 | 0 | 0 | 1 | | 10 | 13 | 106 | 56 | 238 | +------+------+------+------+------+ CEBPA Mdom +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 267 | 48 | 112 | 4 | | 2 | 0 | 0 | 0 | 431 | | 3 | 0 | 0 | 9 | 422 | | 4 | 19 | 0 | 374 | 38 | | 5 | 0 | 426 | 5 | 0 | | 6 | 255 | 74 | 22 | 80 | | 7 | 79 | 243 | 7 | 102 | | 8 | 307 | 122 | 0 | 2 | | 9 | 424 | 0 | 0 | 7 | | 10 | 19 | 134 | 52 | 226 | +------+------+------+------+------+ CEBPA Ggal +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 172 | 45 | 100 | 12 | | 2 | 0 | 1 | 0 | 328 | | 3 | 0 | 0 | 0 | 329 | | 4 | 31 | 0 | 273 | 25 | | 5 | 0 | 329 | 0 | 0 | | 6 | 212 | 17 | 54 | 46 | | 7 | 77 | 162 | 6 | 84 | | 8 | 245 | 84 | 0 | 0 | | 9 | 309 | 0 | 8 | 12 | | 10 | 9 | 117 | 62 | 141 | +------+------+------+------+------+ HNF4A Hsap +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 17 | 6 | 15 | 102 | | 2 | 12 | 7 | 116 | 5 | | 3 | 31 | 19 | 75 | 15 | | 4 | 91 | 35 | 4 | 10 | | 5 | 4 | 131 | 0 | 5 | | 6 | 18 | 6 | 0 | 116 | | 7 | 0 | 28 | 4 | 108 | | 8 | 5 | 4 | 0 | 131 | | 9 | 16 | 3 | 116 | 5 | | 10 | 34 | 42 | 52 | 12 | | 11 | 61 | 56 | 3 | 20 | | 12 | 16 | 102 | 7 | 15 | | 13 | 19 | 51 | 6 | 64 | +------+------+------+------+------+ HNF4A Mmus +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 39 | 24 | 24 | 163 | | 2 | 36 | 0 | 193 | 21 | | 3 | 58 | 54 | 117 | 21 | | 4 | 145 | 81 | 3 | 21 | | 5 | 0 | 244 | 6 | 0 | | 6 | 21 | 53 | 0 | 176 | | 7 | 18 | 74 | 11 | 147 | | 8 | 10 | 2 | 0 | 238 | | 9 | 22 | 0 | 226 | 2 | | 10 | 51 | 80 | 78 | 41 | | 11 | 70 | 122 | 18 | 40 | | 12 | 22 | 191 | 8 | 29 | | 13 | 52 | 70 | 9 | 119 | +------+------+------+------+------+ HNF4A Cfam +------+------+------+------+------+ | pos | a | c | g | t | +------+------+------+------+------+ | 1 | 15 | 22 | 20 | 115 | | 2 | 15 | 0 | 140 | 17 | | 3 | 45 | 18 | 91 | 18 | | 4 | 102 | 57 | 2 | 11 | | 5 | 8 | 149 | 0 | 15 | | 6 | 8 | 25 | 0 | 139 | | 7 | 2 | 62 | 7 | 101 | | 8 | 3 | 1 | 0 | 168 | | 9 | 11 | 6 | 155 | 0 | | 10 | 45 | 74 | 31 | 22 | | 11 | 46 | 83 | 11 | 32 | | 12 | 14 | 135 | 10 | 13 | | 13 | 21 | 52 | 4 | 95 | +------+------+------+------+------+